rs10826862 chr10:30752205 A>G
- Sequence
gaattgacagagccttatgtccac[A/G]atgaagtcacatccaacaaaaagt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM02630 (Fanconi anemi) GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.89 | 3.16 | 1.85 | n/a | No Hit | |||
| STAG1_HUMAN | n/a | 4.45 | 3.00 | n/a | n/a | |||
| IKZF2_HUMAN | -2.60 | 2.49 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, total cholesterol, total cholesterol change with statins, waist hip ratio