rs10827440 chr10:34836534 A>C
- Sequence
cagaataaaagctttgcaggatcc[A/C]aggaaaccctgggtgttttggtcc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.35 | 1.05 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.44 | 0.00 | 1.00 |
Items per page:
1 – 2 of 2