rs10827492 chr10:35140897 C>T
- Sequence
tctgattaggaggctggcatgcag[C/T]gtgttggaaagagtagagggactg
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | -0.73 | 1.74 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, irritible bowel syndrome, parkinsons disease (pd), primary rhegmatogenous retinal detachment
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Muscle_Skeletal, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood