rs10829001 chr10:26449016 G>T
- Sequence
ctccaaaaatacgcctgtctttca[G/T]gggagggcagtagtgctaagattt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia) GM02630 (Fanconi anemi) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.95 | -0.68 | 1.32 | -2.52 | Concordant | |||
| STAG1_HUMAN | 1.27 | 0.57 | 1.40 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood