rs10829002 chr10:26449025 A>G
- Sequence
tacgcctgtctttcaggggagggc[A/G]gtagtgctaagatttggaaaatgg
- ASB in cell types
- GM02630 (Fanconi anemi) MOLT-4 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.06 | -0.29 | 1.33 | 0.86 | Weak Discordant | |||
| STAG1_HUMAN | 1.33 | 0.33 | 1.41 | n/a | n/a | |||
| FOXK2_HUMAN | 2.15 | -1.95 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood