rs10831676 chr11:11798902 A>C
- Sequence
caagatgccaagtagatccctaac[A/C]ctccttgcagtgataacaagataa
- ASB in cell types
- A549 (lung carcinoma) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.20 | 1.07 | 2.00 | |||
| thyroid gland | 2.25 | -1.83 | 1.00 |
Items per page:
1 – 2 of 2