rs10831724 chr11:12086073 A>G
- Sequence
gcctgatgactagctgtgcaaaca[A/G]aacctcggacttccctccgcattt
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- GCR_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.36 | 1.27 | 2.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.37 | 1.09 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, lp-pla2 mass, mitral annular calcium, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach