rs10831998 chr11:13210474 C>T
- Sequence
taaaaattgcttgaagcaaacaaa[C/T]aaacaaaatcccaagaggtgtgta
- ASB in cell types
- A549 (lung carcinoma) D54 (H54, Human glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.05 | 0.58 | 2.00 | |||
| D54 (H54, Human glioblastoma) | 1.89 | -0.99 | 1.50 |
Items per page:
1 – 2 of 2