rs10832027 chr11:13335636 G>A
- Sequence
tgcttaaaattatctgggcctaga[G/A]tctgactccaattaacacataaac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.02 | 1.16 | 1.99 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI c-reactive protein levels, c-reactive protein levels or triglyceride levels (pleiotropy), lipid traits (pleiotropy) (hipo component 1), psoriasis
GRASP coronary artery disease (cad), hdl cholesterol, proximal gene expression in macrophages (arntl gene), proximal gene expression in monocytes (arntl gene), sporadic creutzfeldt-jakob disease, total cholesterol change with statins, triglycerides, years of education