rs10832314 chr11:14904868 A>G
- Sequence
cgccacatggggatttctggttga[A/G]cagttttcagagaatgaaatcagt
- ASB in cell types
- 22RV1 (prostate carcinoma) neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.70 | 1.52 | 1.50 | |||
| neutrophils from periferal blood | 1.71 | -0.01 | 1.50 |
Items per page:
1 – 2 of 2