rs10832831 chr11:17648709 G>C
- Sequence
cgggagggtggctccaggctttca[G/C]acacctgttccccacatctgaccc
- ASB for transcription factors
- MYOD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYOD1_HUMAN | 1.73 | -0.33 | 1.67 | -1.84 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
