rs10833077 chr11:19243323 T>A
- Sequence
atctgtgatctacagggccattca[T/A]gctgcagatgtctgagtgacagtt
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TMD8 (diffuse large B-cell lymphoma) | -4.65 | 2.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, total cholesterol change with statins