rs10833259 chr11:20163412 G>A
- Sequence
tttaaggtccttgcctacgctgcg[G/A]gggaggccgcagcagatccggctg
- ASB in cell types
- MCF10A (breast epithelial cells) MRC-iPS-25 (induced pluripotent stem cells)
- ASB for transcription factors
- TEAD4_HUMAN JARD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -2.84 | 2.74 | 1.00 | n/a | No Hit | |||
| JARD2_HUMAN | -0.99 | 1.86 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), college completion, fasting blood glucose, hdl cholesterol, infant head circumference, systolic blood pressure (sbp)