rs10834936 chr11:26278513 T>C
- Sequence
cagagtcacatgtatccctcagac[T/C]ttactgtttactgtttattgtcac
- ASB in cell types
- HeLa (cervical adenocarcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 2.35 | -0.11 | 2.00 | |||
| LNCaP (prostate carcinoma) | 1.31 | -0.64 | 1.17 |
Items per page:
1 – 2 of 2