rs10835217 chr11:3866612 A>G
- Sequence
agctaatttttgtatatttagtag[A/G]gacggggtttcaccatgttgatca
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 2.35 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Thyroid, Whole_Blood