rs10835416 chr11:28836527 G>T
- Sequence
ttaaagaatgtgtactcagtccag[G/T]catagtgcttggtgctggatataa
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.80 | 0.33 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, ldl cholesterol, obesity with early age of onset (age >2), serum creatinine, total cholesterol