rs10835972 chr11:32792903 T>A
- Sequence
ctacggtacagggtttggggtttg[T/A]ttttttaggattaaatgagataac
- ASB in cell types
- A549 (lung carcinoma) KMS-11 (Plasma cell myeloma) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.91 | 0.06 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | 1.75 | -0.22 | 2.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -1.51 | 1.84 | 1.00 |
Items per page:
1 – 3 of 3