rs10836014 chr11:33039223 T>C
- Sequence
ggctgggatgcggcgcgcgttccg[T/C]ctttccgtatggaaacatggcgcc
- ASB in cell types
- HEK293T (embryonic kidney) HEK293 (embryonic kidney) lymphoblastoid cells T47D (invasive ductal carcinoma)
- ASB for transcription factors
- TYY1_HUMAN MAX_HUMAN STAT1_HUMAN NFRKB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.99 | 0.41 | 1.26 | n/a | No Hit | |||
| MAX_HUMAN | 2.23 | -0.60 | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.86 | 0.93 | 1.67 | n/a | No Hit | |||
| NFRKB_HUMAN | n/a | 3.31 | 2.00 | n/a | n/a | |||
| PKNX1_HUMAN | -1.58 | 1.89 | 1.67 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood