rs10836113 chr11:33808481 T>C
- Sequence
acaggtcctagtcagcggccctcc[T/C]ctccaagcaagctgagtctgcacg
- ASB in cell types
- neutrophils from periferal blood MM1.S (plasma cell myeloma) CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.82 | 0.70 | 1.44 | n/a | No Hit | |||
| STAT1_HUMAN | -1.17 | 1.89 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2