rs10837664 chr11:41522639 T>G
- Sequence
agctgcacccatataaaaggaatt[T/G]catcctgattagatattgaacaat
- ASB in cell types
- primary human neonatal keratinocytes HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary human neonatal keratinocytes | 2.30 | -1.98 | 1.00 | |||
| HCASMC (Human coronary artery smooth muscle cells) | 1.51 | -1.43 | 1.33 |
Items per page:
1 – 2 of 2