rs10838316 chr11:44617105 G>A
- Sequence
acccctcggagctaggaaggaagc[G/A]gtccaggaactgacccctgctgtg
- ASB in cell types
- HeLa (cervical adenocarcinoma) KB (cervical adenocarcinoma) AG04450 (fibroblasts) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -2.26 | 1.70 | 1.50 | |||
| KB (cervical adenocarcinoma) | -1.27 | 2.52 | 2.00 | |||
| AG04450 (fibroblasts) | -2.24 | 2.60 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.92 | -4.38 | 2.00 |
Items per page:
1 – 4 of 4