rs10838519 chr11:45817481 A>T
- Sequence
cttagaagctacatggtctcaggc[A/T]agtcccctaacctttctgggcctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NR2C1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | 2.49 | -2.10 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.42 | -0.43 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, fasting blood glucose, hdl cholesterol, homa-b, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood