rs10838586 chr11:46248890 T>G
- Sequence
cagagaaagacacagatctgatca[T/G]gtcttcccaggcctaaaacccctc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 0.03 | 1.58 | 1.86 | n/a | n/a |
Items per page:
1 – 1 of 1