rs10841333 chr12:19739373 A>G
- Sequence
gtataaagttttaaagacacaatt[A/G]gacaatttaggccagcagatggca
- ASB in cell types
- Kelly (neuroblastoma) HUVEC-C (HUVEC, umbilical vein endothelial cells) CD34+ stem cells-derived erythroblasts hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 0.11 | 1.55 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.08 | -1.64 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | n/a | 3.06 | 2.00 | |||
| hASC (preadipocytes) | -0.88 | 1.44 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | 1.85 | -0.35 | 1.50 |
Items per page:
1 – 5 of 5