rs10842064 chr12:22760488 G>A
- Sequence
agctaggccacagtgttctcttgt[G/A]aaatgtaaacaaccctagagaaca
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN ESR1_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.70 | -0.09 | 1.90 | n/a | No Hit | |||
| ESR1_HUMAN | 2.82 | n/a | 2.00 | n/a | No Hit | |||
| PRGR_HUMAN | 2.54 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins