rs10842240 chr12:23907141 G>C
- Sequence
acctgtcaggcctaagtttgggag[G/C]tgtctgtgtcttgtttatatatgc
- ASB in cell types
- CHL-1 (Melanoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.22 | 2.33 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1