rs10842944 chr12:27589733 T>C
- Sequence
tcttctaaagtattttggttgagt[T/C]cgtcctagagcttaattgcgagag
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 1.67 | -0.39 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1