rs10843539 chr12:29889855 G>A
- Sequence
gaagaaagattggcagggatggag[G/A]tcacaggaacaggaagagcaaatc
- ASB in cell types
- SK-N-SH (neuroblastoma) H929 (plasma cell myeloma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -0.27 | 2.59 | 1.30 | |||
| H929 (plasma cell myeloma) | 2.24 | -2.06 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -1.72 | 2.56 | 2.00 |
Items per page:
1 – 3 of 3