rs10845183 chr12:10611420 A>T
- Sequence
gcccagacacagctataatgtgca[A/T]caggtactctaaaatgatagaaat
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | -2.10 | 2.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood