rs10845387 chr12:11604809 G>A
- Sequence
aattagagttgtgttgttaagcag[G/A]taagagtctctcaagtgctgagtg
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | -0.42 | 1.28 | 1.44 | 2.38 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, triglycerides, triglycerides change with statins