rs10845616 chr12:7144656 C>T
- Sequence
atgatttaagagttaggatttctg[C/T]gttccaatcttgttacccctctcc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.16 | -2.00 | 1.50 | |||
| foreskin keratinocyte | n/a | 0.69 | 2.50 | |||
| LUHMES (lund human mesencephalic cells) | 1.64 | -1.01 | 1.00 |
Items per page:
1 – 3 of 3