rs10845934 chr12:14239565 T>C
- Sequence
gtagacatgaaacagcacacccta[T/C]cccaatggttaaccagaggcaata
- ASB in cell types
- foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines) EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.38 | -4.40 | 2.33 | |||
| 2588 (Lymphoblastoid Cell Lines) | -1.17 | 1.17 | 1.00 | |||
| EOL-1 (Acute myeloid leukemia) | -0.02 | 1.39 | 1.00 |
Items per page:
1 – 3 of 3