rs10845987 chr12:14367307 T>C
- Sequence
agatgtaattgaaagtaatacttt[T/C]ggttggtggatttttaaatgacgt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ATF2_HUMAN CREB1_HUMAN SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | -0.43 | 2.17 | 1.00 | n/a | No Hit | |||
| CREB1_HUMAN | -0.19 | 1.64 | 1.47 | n/a | No Hit | |||
| SPT5H_HUMAN | n/a | 1.61 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, college completion, eye color, height, neuroblastoma (brain cancer), obesity with early age of onset (age >2), resistance to kuru in aged women despite likely exposure, years of education
GTEx eQTL Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung