rs10846215 chr12:15584481 T>G
- Sequence
agaagagtcacatagattattgct[T/G]ggtcagtactatgcttcttgtcct
- ASB in cell types
- foreskin keratinocyte sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.72 | n/a | 2.00 | |||
| sigmoid colon | 1.68 | -0.97 | 1.00 |
Items per page:
1 – 2 of 2