rs10846397 chr12:16685381 A>T
- Sequence
ggaagatagtaataagatatagaa[A/T]gtaaagaaaaaaactcttcaatgt
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -1.02 | 1.76 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.59 | -0.91 | 1.00 |
Items per page:
1 – 2 of 2