rs10846666 chr12:124399807 A>G
- Sequence
ctaacagctaaacaaagtagagac[A/G]acagacgcacaccgctgccccctg
- ASB in cell types
- THP-1 (acute monocytic leukemia) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.62 | 1.15 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | -0.01 | 0.98 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), height, microalbuminuria, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease