rs10846667 chr12:124399878 C>T
- Sequence
ctcacatcatctcatttttttcta[C/T]tttctgggagggtagtgagggatg
- ASB in cell types
- MCF10AT1 (breast premetastatic epithelial cells) uterus OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10AT1 (breast premetastatic epithelial cells) | 2.24 | -1.91 | 1.00 | |||
| uterus | -1.57 | 1.87 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.98 | -0.18 | 1.17 |
Items per page:
1 – 3 of 3