rs10846668 chr12:124399897 G>A
- Sequence
ttctactttctgggagggtagtga[G/A]ggatgaacacccttctcaacagaa
- ASB in cell types
- fibroblast of pulmonary artery MCF10AT1 (breast premetastatic epithelial cells) HPF (pulmonary fibroblasts isolated from lung tissue) sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fibroblast of pulmonary artery | 2.82 | n/a | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 2.25 | -1.91 | 1.00 | |||
| HPF (pulmonary fibroblasts isolated from lung tissue) | 2.38 | n/a | 1.00 | |||
| sigmoid colon | -1.25 | 1.66 | 1.00 |
Items per page:
1 – 4 of 4