rs10846699 chr12:122368526 T>C
- Sequence
ccatttaatctcacagtgcctgag[T/C]gcataaagctataaaatgtctcaa
- ASB in cell types
- LNCaP (prostate carcinoma) PANC1 (pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- FOXA1_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.33 | 2.50 | 1.60 | n/a | No Hit | |||
| FOXA2_HUMAN | 0.50 | 1.67 | 2.38 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, birth weight, body mass index (bmi), college completion, hdl cholesterol, height, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood