rs10846710 chr12:124681403 C>T
- Sequence
tgcctcagcctcccaagctgcaca[C/T]ccttttttttaatatcgtctgtgg
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.44 | 2.36 | 1.73 | 4.69 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, fasting blood glucose, ldl cholesterol change with statins, waist hip ratio