rs10846772 chr12:124927830 G>A
- Sequence
cctcctttttcccccggggggaag[G/A]aaaaagaggaagtgccgaaacccg
- ASB in cell types
- HEK293 (embryonic kidney) macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- ELF1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -1.86 | 1.86 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | 0.62 | 2.32 | 2.62 | 0.82 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
