rs10846874 chr12:125331181 T>C
- Sequence
gggacagcgccggggagggcctgg[T/C]ccgggtgggctcagtccgggctcc
- ASB in cell types
- HeLa (cervical adenocarcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 2.11 | -0.15 | 2.00 | |||
| neural cell | -0.32 | 0.70 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Prostate, Small_Intestine_Terminal_Ileum, Stomach