rs10847332 chr12:127355183 G>C
- Sequence
accttactcagcagtcctgagtgt[G/C]ttcagacatgcttaggctgggcgg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.57 | 2.05 | 1.24 | n/a | n/a |
Items per page:
1 – 1 of 1