rs10847586 chr12:128259667 A>G
- Sequence
tgctagcaacaaatgctagtcagg[A/G]ccaccagggagcgctgtttactct
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.83 | 2.14 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), ldl cholesterol change with statins, total cholesterol change with statins