rs10849441 chr12:6326405 A>G
- Sequence
gtgctcaataaatgagagctctta[A/G]taacgaaagtgtcctgtcccaggc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.34 | 1.93 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.11 | 0.87 | 1.05 |
Items per page:
1 – 2 of 2