rs10849566 chr12:115745 C>T
- Sequence
cagtgccacacagctagtgagtgg[C/T]gggattttaaccacagtcagtctc
- ASB in cell types
- U2OS (osteosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| U2OS (osteosarcoma) | -1.61 | 2.66 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Breast_Mammary_Tissue, Lung, Nerve_Tibial, Whole_Blood