rs10850063 chr12:109346897 G>A
- Sequence
aggatatgttatattacctattca[G/A]ttacaaaaatggaatcatttcttt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.14 | -1.58 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -1.71 | 2.11 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg