rs10851243 chr13:110415152 A>C
- Sequence
tttgataacaaaggggcaacaccc[A/C]gaatgttgggtgatatggagcttt
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -2.54 | 2.46 | 5.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, hdl cholesterol, ldl cholesterol, rheumatoid arthritis, salmonella-induced pyroptosis, total cholesterol