rs10851821 chr15:70368401 T>C
- Sequence
ctgcctcctcaagtgggtcgctga[T/C]ccccatgtaggttgactggaagat
- ASB in cell types
- breast tumor xenograft LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | 2.63 | -2.42 | 1.00 | |||
| LHSAR (prostate epithelial cells) | -0.50 | 2.41 | 1.50 |
Items per page:
1 – 2 of 2