rs10852857 chr17:1452257 T>C
- Sequence
tgggaatattttaataaatggaga[T/C]catattacttatctcactagattg
- ASB in cell types
- LHSAR (prostate epithelial cells) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- ANDR_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.53 | -0.46 | 1.46 | n/a | No Hit | |||
| GCR_HUMAN | 2.35 | -0.63 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, homa-ir, infant head circumference, irritible bowel syndrome, sporadic creutzfeldt-jakob disease, tetrology of fallot, triglycerides change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Nerve_Tibial, Thyroid